The Microarray Manual Curation Tool accepts as input a microarray chip platform (eg. Affymetrix), a probe sequence,
a target sequence and the size of a window that will be used to extract sub-target sequences starting from the
begining of the target. The sub-target sequences will be hybridized with the
probe and each free energy value will be diplayed on a graph. The smaller the
free energy value is, the stronger the hybridization is between the probe
and the sub-target sequence.
-
The MMCT query interface first prompts the user to select an Affymetrix microarray platform (eg. HG_U95Av2) of interest.
-
Next, the user must provide either an Affymetrix probe identifier (eg: 121_at) or directly a DNA probe sequence of interest (eg. ACTGACTGACTGACTG).
For probe identifiers, it is sufficient to introduce only the first few symbols, and a drop-down list of matches will be activated.
-
Then, an Affymetrix target identifier (eg. 121_at) or directly a DNA target sequence of interest (eg. TCGATCAGTACCAGTAACCACACACACAACATAT)
must be provided. Again, a drop-down list of matches will be activated.
-
Last input parameter required from a user is the window size that will be used to select subsequences of the target sequence to be hybridized
with the probe sequence. The hybridization conditions (temperature, sequence and sodium concentration) are preset according to the available
published data from the literature.
-
After submiting the form, hybridization results are computed for all possible hybridizations between the probe and all target subsequences
of "window size" length and a graph is displayed. The graph presents free energy values corresponding to: (i) hybridizations between the probe
and each target subsequence (blue), and (ii) hybridizations between each target subsequence and its corresponding complementary sequence (red).
If the blue and red curves intersect (assuming that window length equals the probe length), the probe sequence represents a complement of a subsequence
of the target sequence. The x-coordinate of the intersection point represents the start position of the subsequence on the target sequence, where the
probe complements the target.
-
The displayed graph can be downloaded as a PNG image.
-
To further explore the hybridizations occured among the probe sequence and all subsequences along the target sequence,
a list of interactions is provided under the graph. The list contains the start position of the target subsequence,
the probe sequence, the target subsequence, the secondary structure in dot-paranthesis notation, and the minimum free energy
of the hybridized sequences measured in kcal/mol.
Each secondary structure in the list of hybridizations can be further explored and visualized.
The secondary structure visualization allows the user to highlight regions on the probe sequence and on the target subsequence (highlighted in yellow).
Also, the secondary structure visualization tool allows zooming in and out, using either automatic 10% increments or custom increments.
Each secondary structure image can be also downloaded as a PNG image.