Options:

Platform: [ Platform for auto-completion ]

Probe sequence or ID:
AffymetrixHG_U133A\1316_at Position=2107 length=25 


[ Example: 121_at ]

Target sequence or ID:
AffymetrixHG_U133A\1316_at length=255 


[ Example: 121_at ]
 
Window size: [ Recommended: probe length ]
 
Sample run

PositionProbe sequenceSub-target sequenceSecondary structureFree energy[kcal/mol]
0agacctaggccaaggaactgggtgggtgttctgcagttcccaggacccca.......(.((..(((((((..... ........)))))))..)).)....-9.62
1agacctaggccaaggaactgggtggtgttctgcagttcccaggaccccat.......(.((..(((((((..... .......)))))))..)).).....-9.62
2agacctaggccaaggaactgggtgggttctgcagttcccaggaccccatc.......(.((..(((((((..... ......)))))))..)).)......-9.62
3agacctaggccaaggaactgggtggttctgcagttcccaggaccccatcc.......(.((..(((((((..... .....)))))))..)).).......-9.62
4agacctaggccaaggaactgggtggtctgcagttcccaggaccccatcct.......(.((..(((((((..... ....)))))))..)).)........-9.62
5agacctaggccaaggaactgggtggctgcagttcccaggaccccatcctc.......(.((..(((((((..... ...)))))))..)).).........-9.62
6agacctaggccaaggaactgggtggtgcagttcccaggaccccatcctct.......(.((..(((((((..... ..)))))))..)).)..........-9.62
7agacctaggccaaggaactgggtgggcagttcccaggaccccatcctctc.......(.((..(((((((..... .)))))))..)).)...........-9.62
8agacctaggccaaggaactgggtggcagttcccaggaccccatcctctca.......(.((..(((((((..... )))))))..)).)............-8.90
9agacctaggccaaggaactgggtggagttcccaggaccccatcctctcag.......(.((..((((((...... ))))))..)).).............-7.46
10agacctaggccaaggaactgggtgggttcccaggaccccatcctctcaga.............((..(((((... ...)))))..)).............-7.11
11agacctaggccaaggaactgggtggttcccaggaccccatcctctcagaa.............((..(((((... ..)))))..))..............-7.11
12agacctaggccaaggaactgggtggtcccaggaccccatcctctcagaag.............((..(((((... .)))))..))...............-7.11
13agacctaggccaaggaactgggtggcccaggaccccatcctctcagaagg.............((..(((((... )))))..))................-6.53
14agacctaggccaaggaactgggtggccaggaccccatcctctcagaaggt............((((...((((.. .....))))..))))..........-6.40
15agacctaggccaaggaactgggtggcaggaccccatcctctcagaaggta............((((...((((.. ....))))..))))...........-6.40
16agacctaggccaaggaactgggtggaggaccccatcctctcagaaggtag............((((...((((.. ...))))..))))............-6.40
17agacctaggccaaggaactgggtggggaccccatcctctcagaaggtagg............((((...((((.. ..))))..)))).............-6.40
18agacctaggccaaggaactgggtgggaccccatcctctcagaaggtaggg............((((...((((.. .))))..))))..............-6.40
19agacctaggccaaggaactgggtggaccccatcctctcagaaggtagggg............((((..((((... ..))))))))...............-6.11
20agacctaggccaaggaactgggtggccccatcctctcagaaggtagggga............((((..((((... .))))))))................-6.11
21agacctaggccaaggaactgggtggcccatcctctcagaaggtaggggaa............((((..((((... )))))))).................-5.59
22agacctaggccaaggaactgggtggccatcctctcagaaggtaggggaag.................(((((.(( ....)).))))).............-4.98
23agacctaggccaaggaactgggtggcatcctctcagaaggtaggggaagg.................(((((.(( ...)).)))))..............-4.98
24agacctaggccaaggaactgggtggatcctctcagaaggtaggggaaggg.................(((((.(( ..)).)))))...............-4.98
25agacctaggccaaggaactgggtggtcctctcagaaggtaggggaagggc.................(((((.(( .)).)))))................-4.98
26agacctaggccaaggaactgggtggcctctcagaaggtaggggaagggcg..((((................... .........))))............-4.59
27agacctaggccaaggaactgggtggctctcagaaggtaggggaagggcgg..((((................... ........)))).............-4.59
28agacctaggccaaggaactgggtggtctcagaaggtaggggaagggcggg..((((................... .......))))..............-4.59
29agacctaggccaaggaactgggtggctcagaaggtaggggaagggcggga...((..(.((.............. .................)).).)).-5.42
30agacctaggccaaggaactgggtggtcagaaggtaggggaagggcgggag...((..(.((.............. ................)).).))..-5.42
31agacctaggccaaggaactgggtggcagaaggtaggggaagggcgggagg...((..(.((.............. ...............)).).))...-5.42
32agacctaggccaaggaactgggtggagaaggtaggggaagggcgggagga...(((.(.((.............. ..............)).)...))).-5.60
33agacctaggccaaggaactgggtgggaaggtaggggaagggcgggaggat...(((.(.((.............. .............)).)...)))..-5.60
34agacctaggccaaggaactgggtggaaggtaggggaagggcgggaggatt...(((.(.((.............. ............)).)...)))...-5.60
35agacctaggccaaggaactgggtggaggtaggggaagggcgggaggattg...(((.(.((.............. ...........)).)...)))....-5.60
36agacctaggccaaggaactgggtggggtaggggaagggcgggaggattga...(((.(.((.............. ..........)).)...))).....-5.60
37agacctaggccaaggaactgggtgggtaggggaagggcgggaggattgag...(((.(.((.............. .........)).)...)))......-5.60
38agacctaggccaaggaactgggtggtaggggaagggcgggaggattgaga...(((.(.((.............. ........)).)...))).......-5.60
39agacctaggccaaggaactgggtggaggggaagggcgggaggattgagaa...(((.(.((.............. .......)).)...)))........-5.60
40agacctaggccaaggaactgggtggggggaagggcgggaggattgagaag...(((.(.((.............. ......)).)...))).........-5.60
41agacctaggccaaggaactgggtgggggaagggcgggaggattgagaagg...(((.(.((.............. .....)).)...)))..........-5.60
42agacctaggccaaggaactgggtggggaagggcgggaggattgagaaggg...(((.(.((.............. ....)).)...)))...........-5.60
43agacctaggccaaggaactgggtgggaagggcgggaggattgagaaggga...(((.(.((.............. ...)).)...)))............-5.60
44agacctaggccaaggaactgggtggaagggcgggaggattgagaagggac...(((.(.((.............. ..)).)...))).............-5.60
45agacctaggccaaggaactgggtggagggcgggaggattgagaagggaca...(((.(.((.............. .)).)...)))..............-5.60
46agacctaggccaaggaactgggtgggggcgggaggattgagaagggacaa...(((..(((.............. .)))...)))...............-5.60
47agacctaggccaaggaactgggtggggcgggaggattgagaagggacaag...(((..(((.............. )))...)))................-5.04
48agacctaggccaaggaactgggtgggcgggaggattgagaagggacaagc...(((................... .....))).................-4.09
49agacctaggccaaggaactgggtggcgggaggattgagaagggacaagcc...(((................... ....)))..................-4.09
50agacctaggccaaggaactgggtgggggaggattgagaagggacaagcca.......(((............... .....................))).-4.41
51agacctaggccaaggaactgggtggggaggattgagaagggacaagccac.......(((............... ....................)))..-4.41
52agacctaggccaaggaactgggtgggaggattgagaagggacaagccacc....................((((( ....................)))))-5.89
53agacctaggccaaggaactgggtggaggattgagaagggacaagccacct....................((((( ...................))))).-6.41
54agacctaggccaaggaactgggtggggattgagaagggacaagccacctt....................((((( ..................)))))..-6.41
55agacctaggccaaggaactgggtgggattgagaagggacaagccaccttg..........(((((...(((.(.. ...............).))))))))-6.47
56agacctaggccaaggaactgggtggattgagaagggacaagccaccttga..........(((((...(((.(.. ..............).)))))))).-7.39
57agacctaggccaaggaactgggtggttgagaagggacaagccaccttgac..........(((((...(((.(.. .............).))))))))..-7.39
58agacctaggccaaggaactgggtggtgagaagggacaagccaccttgacc..........(((((...(((.(.. ............).))))))))...-7.39
59agacctaggccaaggaactgggtgggagaagggacaagccaccttgaccg..........(((((...(((.(.. ...........).))))))))....-7.39
60agacctaggccaaggaactgggtggagaagggacaagccaccttgaccgt..........(((((...(((.(.. ..........).)))))))).....-7.39
61agacctaggccaaggaactgggtgggaagggacaagccaccttgaccgta..........(((((...(((.(.. .........).))))))))......-7.39
62agacctaggccaaggaactgggtggaagggacaagccaccttgaccgtag..........(((((...(((.(.. ........).)))))))).......-7.39
63agacctaggccaaggaactgggtggagggacaagccaccttgaccgtagg...((((.(.(((((...(((.(.. .......).))))))))..).))))-9.15
64agacctaggccaaggaactgggtgggggacaagccaccttgaccgtaggg...((((.(.(((((...(((.(.. ......).))))))))..).)))).-9.59
65agacctaggccaaggaactgggtggggacaagccaccttgaccgtaggga...((((.(.(((((...(((.(.. .....).))))))))..).))))..-9.59
66agacctaggccaaggaactgggtgggacaagccaccttgaccgtagggaa...((((.(.(((((...(((.(.. ....).))))))))..).))))...-9.59
67agacctaggccaaggaactgggtggacaagccaccttgaccgtagggaag...((((.(.(((((...(((.(.. ...).))))))))..).))))....-9.59
68agacctaggccaaggaactgggtggcaagccaccttgaccgtagggaagg...((((.(.(((((...(((.(.. ..).))))))))..).)))).....-9.59
69agacctaggccaaggaactgggtggaagccaccttgaccgtagggaagga...((((.(.(((((...(((.(.. .).))))))))..).))))......-9.59
70agacctaggccaaggaactgggtggagccaccttgaccgtagggaaggag...((((.(.(((((.......... .....)))))..).)))).......-9.13
71agacctaggccaaggaactgggtgggccaccttgaccgtagggaaggagg...((((.(.(((((.......... ....)))))..).))))........-9.13
72agacctaggccaaggaactgggtggccaccttgaccgtagggaaggagga...((((.(.(((((.......... ...)))))..).)))).........-9.13
73agacctaggccaaggaactgggtggcaccttgaccgtagggaaggaggaa...((((.(.(((((.......... ..)))))..).))))..........-9.13
74agacctaggccaaggaactgggtggaccttgaccgtagggaaggaggaat...((((.(.(((((.......... .)))))..).))))...........-9.13
75agacctaggccaaggaactgggtggccttgaccgtagggaaggaggaatg...((((.(.(((((.......... )))))..).))))............-8.17
76agacctaggccaaggaactgggtggcttgaccgtagggaaggaggaatgt...((((.(.((((........... ))))..).)))).............-5.85
77agacctaggccaaggaactgggtggttgaccgtagggaaggaggaatgtg...((((.(................ .....).))))..............-4.13
78agacctaggccaaggaactgggtggtgaccgtagggaaggaggaatgtgg...((((.(................ ....).))))...............-4.13
79agacctaggccaaggaactgggtgggaccgtagggaaggaggaatgtggg...((((.(................ ...).))))................-4.13
80agacctaggccaaggaactgggtggaccgtagggaaggaggaatgtgggc...((((.(................ ..).)))).................-4.13
81agacctaggccaaggaactgggtggccgtagggaaggaggaatgtgggct......((.((.............. ....................)).))-5.47
82agacctaggccaaggaactgggtggcgtagggaaggaggaatgtgggctg......((.((.............. ...................)).)).-5.97
83agacctaggccaaggaactgggtgggtagggaaggaggaatgtgggctgg......((.((.............. ..................)).))..-5.97
84agacctaggccaaggaactgggtggtagggaaggaggaatgtgggctggg...(((((.((.............. .................)).)))))-7.50
85agacctaggccaaggaactgggtggagggaaggaggaatgtgggctgggg...(((((.((.............. ................)).))))).-7.94
86agacctaggccaaggaactgggtgggggaaggaggaatgtgggctggggg...(((((.((.............. ...............)).)))))..-7.94
87agacctaggccaaggaactgggtggggaaggaggaatgtgggctggggga...(((((.((.............. ..............)).)))))...-7.94
88agacctaggccaaggaactgggtgggaaggaggaatgtgggctgggggaa...(((((.((.............. .............)).)))))....-7.94
89agacctaggccaaggaactgggtggaaggaggaatgtgggctgggggaag...(((((.((.............. ............)).))))).....-7.94
90agacctaggccaaggaactgggtggaggaggaatgtgggctgggggaaga...(((((.((.............. ...........)).)))))......-7.94
91agacctaggccaaggaactgggtggggaggaatgtgggctgggggaagat...(((((.((.............. ..........)).))))).......-7.94
92agacctaggccaaggaactgggtgggaggaatgtgggctgggggaagatg...(((((.((.............. .........)).)))))........-7.94
93agacctaggccaaggaactgggtggaggaatgtgggctgggggaagatgc...(((((.((.............. ........)).))))).........-7.94
94agacctaggccaaggaactgggtggggaatgtgggctgggggaagatgcc...(((((.((.............. .......)).)))))..........-7.94
95agacctaggccaaggaactgggtgggaatgtgggctgggggaagatgccc...(((((.((.............. ......)).)))))...........-7.94
96agacctaggccaaggaactgggtggaatgtgggctgggggaagatgccct...(((((.((.............. .....)).)))))............-7.94
97agacctaggccaaggaactgggtggatgtgggctgggggaagatgccctc...(((((.((.............. ....)).))))).............-7.94
98agacctaggccaaggaactgggtggtgtgggctgggggaagatgccctca...(((((.((.............. ...)).)))))..............-7.94
99agacctaggccaaggaactgggtgggtgggctgggggaagatgccctcaa...(((((.((.............. ..)).)))))...............-7.94
100agacctaggccaaggaactgggtggtgggctgggggaagatgccctcaac...(((((.(((............. ))).)))))................-8.03
101agacctaggccaaggaactgggtgggggctgggggaagatgccctcaact...(((((.((.............. )).))))).................-7.33
102agacctaggccaaggaactgggtggggctgggggaagatgccctcaactc...(((.((((.............. ))))..)))................-5.20
103agacctaggccaaggaactgggtgggctgggggaagatgccctcaactca.......(((............... .............))).........-3.93
104agacctaggccaaggaactgggtggctgggggaagatgccctcaactcac.......(((............... ............)))..........-3.93
105agacctaggccaaggaactgggtggtgggggaagatgccctcaactcacc....................((((. .....................))))-4.35
106agacctaggccaaggaactgggtgggggggaagatgccctcaactcaccc...................(((((. ....................)))))-6.24
107agacctaggccaaggaactgggtggggggaagatgccctcaactcacccc...................(((((. ...................))))).-6.55
108agacctaggccaaggaactgggtgggggaagatgccctcaactcaccccc...................(((((. ..................)))))..-6.55
109agacctaggccaaggaactgggtggggaagatgccctcaactcaccccct...................(((((. .................)))))...-6.55
110agacctaggccaaggaactgggtgggaagatgccctcaactcacccccta...................(((((. ................)))))....-6.55
111agacctaggccaaggaactgggtggaagatgccctcaactcaccccctac...................(((((. ...............))))).....-6.55
112agacctaggccaaggaactgggtggagatgccctcaactcaccccctaca...................(((((. ..............)))))......-6.55
113agacctaggccaaggaactgggtgggatgccctcaactcaccccctacac...................(((((. .............))))).......-6.55
114agacctaggccaaggaactgggtggatgccctcaactcaccccctacaca...................(((((. ............)))))........-6.55
115agacctaggccaaggaactgggtggtgccctcaactcaccccctacacac...................(((((. ...........))))).........-6.55
116agacctaggccaaggaactgggtgggccctcaactcaccccctacacaca...................(((((. ..........)))))..........-6.55
117agacctaggccaaggaactgggtggccctcaactcaccccctacacacac...................(((((. .........)))))...........-6.55
118agacctaggccaaggaactgggtggcctcaactcaccccctacacacaca...................(((((. ........)))))............-6.55
119agacctaggccaaggaactgggtggctcaactcaccccctacacacacat...................(((((. .......))))).............-6.55
120agacctaggccaaggaactgggtggtcaactcaccccctacacacacatg...................(((((. ......)))))..............-6.55
121agacctaggccaaggaactgggtggcaactcaccccctacacacacatga...................(((((. .....)))))...............-6.55
122agacctaggccaaggaactgggtggaactcaccccctacacacacatgag...................(((((. ....)))))................-6.55
123agacctaggccaaggaactgggtggactcaccccctacacacacatgaga...................(((((. ...))))).................-6.55
124agacctaggccaaggaactgggtggctcaccccctacacacacatgagag...................(((((. ..)))))..................-6.55
125agacctaggccaaggaactgggtggtcaccccctacacacacatgagaga...................(((((. .)))))...................-6.55
126agacctaggccaaggaactgggtggcaccccctacacacacatgagagag...................(((((. )))))....................-5.97
127agacctaggccaaggaactgggtggaccccctacacacacatgagagaga...................((((.. )))).....................-4.53
128agacctaggccaaggaactgggtggccccctacacacacatgagagagag...................(.(((. .......))).).............-4.25
129agacctaggccaaggaactgggtggcccctacacacacatgagagagagc...................(.(((. ......))).)..............-4.25
130agacctaggccaaggaactgggtggccctacacacacatgagagagagcc...................(.(((. .....))).)...............-4.25
131agacctaggccaaggaactgggtggcctacacacacatgagagagagccc...................(.(((. ....))).)................-4.25
132agacctaggccaaggaactgggtggctacacacacatgagagagagcccc...................(.(((. ...))).).................-4.25
133agacctaggccaaggaactgggtggtacacacacatgagagagagccccc...................(.(((. ..))).)..................-4.25
134agacctaggccaaggaactgggtggacacacacatgagagagagccccca...................(.(((. .))).)...................-4.25
135agacctaggccaaggaactgggtggcacacacatgagagagagcccccac...................(.(((. ..))).)..................-4.25
136agacctaggccaaggaactgggtggacacacatgagagagagcccccacc....................((((( ....................)))))-5.69
137agacctaggccaaggaactgggtggcacacatgagagagagcccccaccc...................(((((( ...................))))))-7.58
138agacctaggccaaggaactgggtggacacatgagagagagcccccaccca...................(((((( ..................)))))).-8.40
139agacctaggccaaggaactgggtggcacatgagagagagcccccacccag.................(((((((( .................))))))))-10.66
140agacctaggccaaggaactgggtggacatgagagagagcccccacccagt................((((((((( ................)))))))))-11.60
141agacctaggccaaggaactgggtggcatgagagagagcccccacccagtt...............(((((((((( ...............))))))))))-12.71
142agacctaggccaaggaactgggtggatgagagagagcccccacccagttc..............((((((((((( ..............)))))))))))-14.00
143agacctaggccaaggaactgggtggtgagagagagcccccacccagttcc.............(((((((((((( .............))))))))))))-15.86
144agacctaggccaaggaactgggtgggagagagagcccccacccagttcct............((((((((((((( ............)))))))))))))-17.02
145agacctaggccaaggaactgggtggagagagagcccccacccagttcctt...........(((((((((((((( ...........))))))))))))))-17.93
146agacctaggccaaggaactgggtgggagagagcccccacccagttccttg..........((((((((((((((( ..........)))))))))))))))-19.53
147agacctaggccaaggaactgggtggagagagcccccacccagttccttgg.........(((((((((((((((( .........))))))))))))))))-21.57
148agacctaggccaaggaactgggtgggagagcccccacccagttccttggc........((((((((((((((((( ........)))))))))))))))))-23.65
149agacctaggccaaggaactgggtggagagcccccacccagttccttggcc.......(((((((((((((((((( .......))))))))))))))))))-25.51
150agacctaggccaaggaactgggtgggagcccccacccagttccttggcct......((((((((((((((((((( ......)))))))))))))))))))-26.87
151agacctaggccaaggaactgggtggagcccccacccagttccttggccta......((((((((((((((((((( .....))))))))))))))))))).-27.35
152agacctaggccaaggaactgggtgggcccccacccagttccttggcctag....((((((((((((((((((((( ....)))))))))))))))))))))-28.59
153agacctaggccaaggaactgggtggcccccacccagttccttggcctagg...(((((((((((((((((((((( ...))))))))))))))))))))))-30.87
154agacctaggccaaggaactgggtggccccacccagttccttggcctaggt..((((((((((((((((((((((( ..)))))))))))))))))))))))-31.92
155agacctaggccaaggaactgggtggcccacccagttccttggcctaggtc.(((((((((((((((((((((((( .))))))))))))))))))))))))-33.23
156agacctaggccaaggaactgggtggccacccagttccttggcctaggtct((((((((((((((((((((((((( )))))))))))))))))))))))))-33.36
157agacctaggccaaggaactgggtggcacccagttccttggcctaggtctc((((((((((((((((((((((((. )))))))))))))))))))))))).-32.15
158agacctaggccaaggaactgggtggacccagttccttggcctaggtctcc(((((((((((((((((((((((.. )))))))))))))))))))))))..-30.71
159agacctaggccaaggaactgggtggcccagttccttggcctaggtctccc((((((((((((((((((((((... ))))))))))))))))))))))...-29.17
160agacctaggccaaggaactgggtggccagttccttggcctaggtctcccc(((((((((((((((((((((.... )))))))))))))))))))))....-27.42
161agacctaggccaaggaactgggtggcagttccttggcctaggtctcccct((((((((((((((((((((..... )))))))))))))))))))).....-25.58
162agacctaggccaaggaactgggtggagttccttggcctaggtctcccctc(((((((((((((((((((...... )))))))))))))))))))......-24.14
163agacctaggccaaggaactgggtgggttccttggcctaggtctcccctcc((((((((((((((((((....... )))))))))))))))))).......-22.93
164agacctaggccaaggaactgggtggttccttggcctaggtctcccctcca(((((((((((((((((........ )))))))))))))))))........-20.64
165agacctaggccaaggaactgggtggtccttggcctaggtctcccctccag(((((((((((((((.......... .))))))))))))))).........-20.17
166agacctaggccaaggaactgggtggccttggcctaggtctcccctccagg(((((((((((((((.......... )))))))))))))))..........-19.59
167agacctaggccaaggaactgggtggcttggcctaggtctcccctccaggc((((((((((((((........... ))))))))))))))...........-17.27
168agacctaggccaaggaactgggtggttggcctaggtctcccctccaggct(((((((((((((............ )))))))))))))............-15.51
169agacctaggccaaggaactgggtggtggcctaggtctcccctccaggctg((((((((((((............. )))))))))))).............-14.62
170agacctaggccaaggaactgggtggggcctaggtctcccctccaggctga(((((((((((.............. )))))))))))..............-13.92
171agacctaggccaaggaactgggtgggcctaggtctcccctccaggctgag((((((((((............... ))))))))))...............-11.57
172agacctaggccaaggaactgggtggcctaggtctcccctccaggctgagg(((((((((................ )))))))))................-9.25
173agacctaggccaaggaactgggtggctaggtctcccctccaggctgaggg...(((.((((..(((...(((... .........)))))).)))).))).-8.87
174agacctaggccaaggaactgggtggtaggtctcccctccaggctgagggc...(((.((((..(((...(((... ........)))))).)))).)))..-8.87
175agacctaggccaaggaactgggtggaggtctcccctccaggctgagggcc.(.(((.((((..(((...(((... .......)))))).)))).))).).-9.14
176agacctaggccaaggaactgggtggggtctcccctccaggctgagggcct.(.(((.((((..(((...(((... ......)))))).)))).))).)..-9.14
177agacctaggccaaggaactgggtgggtctcccctccaggctgagggcctc.(.(((.((((..(((...(((... .....)))))).)))).))).)...-9.14
178agacctaggccaaggaactgggtggtctcccctccaggctgagggcctct.(.(((.((((..(((...(((... ....)))))).)))).))).)....-9.14
179agacctaggccaaggaactgggtggctcccctccaggctgagggcctctc.(.(((.((((..(((...(((... ...)))))).)))).))).).....-9.14
180agacctaggccaaggaactgggtggtcccctccaggctgagggcctctct.(.(((.((((..(((...(((... ..)))))).)))).))).)......-9.14
181agacctaggccaaggaactgggtggcccctccaggctgagggcctctcta.(.(((.((((..(((...(((... .)))))).)))).))).).......-9.14
182agacctaggccaaggaactgggtggccctccaggctgagggcctctctac.(.(((.((((..(((...(((... )))))).)))).))).)........-8.62
183agacctaggccaaggaactgggtggcctccaggctgagggcctctctact......(((((..((..((((.... ...)))).))...))))).......-8.00
184agacctaggccaaggaactgggtggctccaggctgagggcctctctactt......(((((..((..((((.... ..)))).))...)))))........-8.00
185agacctaggccaaggaactgggtggtccaggctgagggcctctctacttc......(((((..((..((((.... .)))).))...))))).........-8.00
186agacctaggccaaggaactgggtggccaggctgagggcctctctacttcc......(((((.............. ..........)))))..........-7.47
187agacctaggccaaggaactgggtggcaggctgagggcctctctacttccc......(((((.............. .........)))))...........-7.47
188agacctaggccaaggaactgggtggaggctgagggcctctctacttcccc......(((((.............. ........)))))............-7.47
189agacctaggccaaggaactgggtggggctgagggcctctctacttcccca......(((((.............. .......))))).............-7.47
190agacctaggccaaggaactgggtgggctgagggcctctctacttccccag......(((((.............. ......)))))..............-7.47
191agacctaggccaaggaactgggtggctgagggcctctctacttccccaga......(((((.............. .....)))))...............-7.47
192agacctaggccaaggaactgggtggtgagggcctctctacttccccagat......(((((.............. ....)))))................-7.47
193agacctaggccaaggaactgggtgggagggcctctctacttccccagatg......(((((.............. ...))))).................-7.47
194agacctaggccaaggaactgggtggagggcctctctacttccccagatgc......(((((.............. ..)))))..................-7.47
195agacctaggccaaggaactgggtgggggcctctctacttccccagatgcc......(((((.............. .)))))...................-7.47
196agacctaggccaaggaactgggtggggcctctctacttccccagatgcct......((((.....(.(((((... ..............))))).)))))-7.21
197agacctaggccaaggaactgggtgggcctctctacttccccagatgcctg......((((.....(.(((((... .............))))).))))).-7.71
198agacctaggccaaggaactgggtggcctctctacttccccagatgcctgg......((((.....(.(((((... ............))))).)))))..-7.71
199agacctaggccaaggaactgggtggctctctacttccccagatgcctggg...(((((((.....(.(((((... ...........))))).))))))))-9.24
200agacctaggccaaggaactgggtggtctctacttccccagatgcctgggt..((((((((.....(.(((((... ..........))))).)))))))))-10.29
201agacctaggccaaggaactgggtggctctacttccccagatgcctgggtg..((((((((.....(.(((((... .........))))).))))))))).-10.79
202agacctaggccaaggaactgggtggtctacttccccagatgcctgggtgc..((((((((.....(.(((((... ........))))).)))))))))..-10.79
203agacctaggccaaggaactgggtggctacttccccagatgcctgggtgca..((((((((.....(.(((((... .......))))).)))))))))...-10.79
204agacctaggccaaggaactgggtggtacttccccagatgcctgggtgcaa..((((((((.....(.(((((... ......))))).)))))))))....-10.79
205agacctaggccaaggaactgggtggacttccccagatgcctgggtgcaaa..((((((((.....(.(((((... .....))))).))))))))).....-10.79
206agacctaggccaaggaactgggtggcttccccagatgcctgggtgcaaag..((((((((.....(.(((((... ....))))).)))))))))......-10.79
207agacctaggccaaggaactgggtggttccccagatgcctgggtgcaaaga..((((((((.....(.(((((... ...))))).))))))))).......-10.79
208agacctaggccaaggaactgggtggtccccagatgcctgggtgcaaagaa..((((((((.....(.(((((... ..))))).)))))))))........-10.79
209agacctaggccaaggaactgggtggccccagatgcctgggtgcaaagaac..((((((((.....(.(((((... .))))).))))))))).........-10.79
210agacctaggccaaggaactgggtggcccagatgcctgggtgcaaagaacg..((((((((.....(.(((((... ))))).)))))))))..........-10.27
211agacctaggccaaggaactgggtggccagatgcctgggtgcaaagaacgg..((((((((............... ......))))))))...........-8.56
212agacctaggccaaggaactgggtggcagatgcctgggtgcaaagaacggc..((((((((............... .....))))))))............-8.56
213agacctaggccaaggaactgggtggagatgcctgggtgcaaagaacggct..((((((((............... ....)))))))).............-8.56
214agacctaggccaaggaactgggtgggatgcctgggtgcaaagaacggctt..((((((((............... ...))))))))..............-8.56
215agacctaggccaaggaactgggtggatgcctgggtgcaaagaacggcttg..((((((((............... ..))))))))...............-8.56
216agacctaggccaaggaactgggtggtgcctgggtgcaaagaacggcttgg..((((((((............... .))))))))................-8.56
217agacctaggccaaggaactgggtgggcctgggtgcaaagaacggcttggc..((((((((............... )))))))).................-7.95
218agacctaggccaaggaactgggtggcctgggtgcaaagaacggcttggct........((((((........... ..................)))))).-8.09
219agacctaggccaaggaactgggtggctgggtgcaaagaacggcttggctt........((((((........... .................))))))..-8.09
220agacctaggccaaggaactgggtggtgggtgcaaagaacggcttggcttg........((((((........... ................))))))...-8.09
221agacctaggccaaggaactgggtgggggtgcaaagaacggcttggcttgg........((((((........... ...............))))))....-8.09
222agacctaggccaaggaactgggtggggtgcaaagaacggcttggcttggc...((..(((((((........... ..............))))))).)).-8.16
223agacctaggccaaggaactgggtgggtgcaaagaacggcttggcttggct...((..(((((((........... .............))))))).))..-8.16
224agacctaggccaaggaactgggtggtgcaaagaacggcttggcttggctc...((..(((((((........... ............))))))).))...-8.16
225agacctaggccaaggaactgggtgggcaaagaacggcttggcttggctcc...((..(((((((........... ...........))))))).))....-8.16
226agacctaggccaaggaactgggtggcaaagaacggcttggcttggctcct...((..(((((((........... ..........))))))).)).....-8.16
227agacctaggccaaggaactgggtggaaagaacggcttggcttggctcctc...((..(((((((........... .........))))))).))......-8.16
228agacctaggccaaggaactgggtggaagaacggcttggcttggctcctcc...((..(((((((........... ........))))))).)).......-8.16
229agacctaggccaaggaactgggtggagaacggcttggcttggctcctcct...((..(((((((........... .......))))))).))........-8.16
230agacctaggccaaggaactgggtgggaacggcttggcttggctcctcctc...((..(((((((........... ......))))))).)).........-8.16

Download image: image.png

Color legend:

 
blue:  free energies for probe and target subsequences of 'window size'.
red:  perfect match free energies for target subsequences of 'window size'.
The curves intersect when a probe perfectly matches a subsequence on the target.

 

 



Reference: Tulpan, D., Belliveau, L., Leger, S., The microarray manual curation tool (MMCT): A Webserver for microarray probe evaluations, Bioinformation, 4(8):344-346 (2010). [PDF]